Differential Expression of Endogenous Retroviruses and Inflammatory Mediators in Female and Male Offspring in a Mouse Model of Maternal Immune Activation
Abstract
:1. Introduction
2. Results
2.1. Poly I:C Mice Showed Tissue-Specific Expression of Several ERVs, ERV-Related Genes, and Inflammatory Mediators
2.2. Poly I:C Mice Showed Sex-Dependent Differences in the Expression of ERV, ERV-Related Genes, and Inflammatory Mediators in Prefrontal Cortex
2.3. Behavioral Profile of Poly I:C Mice and Correlations of Social Behavioral Responses with ERV, ERV-Related Genes, and Inflammatory Mediators
3. Discussion
4. Materials and Methods
4.1. Animals and Treatments
4.2. Behavioral Assessment
4.3. Tissue Collection
4.4. RNA Extraction from PFC, HP, and BL Samples
4.5. RT Real-Time PCR Assay
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brown, A.S.; Derkits, E.J. Prenatal infection and schizophrenia: A review of epidemiologic and translational studies. Am. J. Psychiatry 2010, 167, 261–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parboosing, R.; Bao, Y.; Shen, L.; Schaefer, C.A.; Brown, A.S. Gestational influenza and bipolar disorder in adult offspring. JAMA Psychiatry 2013, 70, 677–685. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, V.X.; Patel, S.; Jones, H.F.; Nielsen, T.C.; Mohammad, S.S.; Hofer, M.J.; Gold, W.; Brilot, F.; Lain, S.J.; Nassar, N.; et al. Maternal acute and chronic inflammation in pregnancy is associated with common neurodevelopmental disorders: A systematic review. Transl. Psychiatry 2021, 11, 71. [Google Scholar] [CrossRef] [PubMed]
- Massarali, A.; Adhya, D.; Srivastava, D.P.; Baron-Cohen, S.; Kotter, M.R. Virus-Induced Maternal Immune Activation as an Environmental Factor in the Etiology of Autism and Schizophrenia. Front. Neurosci. 2022, 16, 834058. [Google Scholar] [CrossRef]
- Knuesel, I.; Chicha, L.; Britschgi, M.; Schobel, S.A.; Bodmer, M.; Hellings, J.A.; Toovey, S.; Prinssen, E.P. Maternal immune activation and abnormal brain development across CNS disorders. Nat. Rev. Neurol. 2014, 10, 643–660. [Google Scholar] [CrossRef]
- Che, X.; Hornig, M.; Bresnahan, M.; Stoltenberg, C.; Magnus, P.; Surén, P.; Mjaaland, S.; Reichborn-Kjennerud, T.; Susser, E.; Lipkin, W.I. Maternal mid-gestational and child cord blood immune signatures are strongly associated with offspring risk of ASD. Mol. Psychiatry 2022, 27, 1527–1541. [Google Scholar] [CrossRef]
- Shuid, A.N.; Jayusman, P.A.; Shuid, N.; Ismail, J.; Nor, N.K.; Mohamed, I.N. Association between Viral Infections and Risk of Autistic Disorder: An Overview. Int. J. Environ. Res. Public Health 2021, 18, 2817. [Google Scholar] [CrossRef]
- Kentner, A.C.; Bilbo, S.D.; Brown, A.S.; Hsiao, E.Y.; McAllister, A.K.; Meyer, U.; Pearce, B.D.; Pletnikov, M.V.; Yolken, R.H.; Bauman, M.D. Maternal immune activation: Reporting guidelines to improve the rigor, reproducibility, and transparency of the model. Neuropsychopharmacology 2019, 44, 245–258. [Google Scholar] [CrossRef] [Green Version]
- Ornoy, A.; Weinstein-Fudim, L.; Ergaz, Z. Prevention or Amelioration of Autism-Like Symptoms in Animal Models: Will it Bring Us Closer to Treating Human ASD? Int. J. Mol. Sci. 2019, 20, 1074. [Google Scholar] [CrossRef] [Green Version]
- Kwon, H.K.; Choi, G.B.; Huh, J.R. Maternal inflammation and its ramifications on fetal neurodevelopment. Trends Immunol. 2022, 43, 230–244. [Google Scholar] [CrossRef]
- Dahlgren, J.; Samuelsson, A.M.; Jansson, T.; Holmäng, A. Interleukin-6 in the maternal circulation reaches the rat fetus in mid-gestation. Pediatr. Res. 2006, 60, 147–151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hsiao, E.Y.; Patterson, P.H. Activation of the maternal immune system induces endocrine changes in the placenta via IL-6. Brain Behav. Immun. 2011, 25, 604–615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tartaglione, A.M.; Villani, A.; Ajmone-Cat, M.A.; Minghetti, L.; Ricceri, L.; Pazienza, V.; De Simone, R.; Calamandrei, G. Maternal immune activation induces autism-like changes in behavior, neuroinflammatory profile and gut microbiota in mouse offspring of both sexes. Transl. Psychiatry 2022, 12, 384. [Google Scholar] [CrossRef]
- Balestrieri, E.; Arpino, C.; Matteucci, C.; Sorrentino, R.; Pica, F.; Alessandrelli, R.; Coniglio, A.; Curatolo, P.; Rezza, G.; Macciardi, F.; et al. HERVs expression in Autism Spectrum Disorders. PLoS ONE 2012, 7, e48831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balestrieri, E.; Cipriani, C.; Matteucci, C.; Capodicasa, N.; Pilika, A.; Korca, I.; Sorrentino, R.; Argaw-Denboba, A.; Bucci, I.; Miele, M.T.; et al. Transcriptional activity of human endogenous retrovirus in Albanian children with autism spectrum disorders. New Microbiol. 2016, 39, 228–231. [Google Scholar]
- Balestrieri, E.; Pitzianti, M.; Matteucci, C.; D’Agati, E.; Sorrentino, R.; Baratta, A.; Caterina, R.; Zenobi, R.; Curatolo, P.; Garaci, E.; et al. Human endogenous retroviruses and ADHD. World J. Biol. Psychiatry 2014, 15, 499–504. [Google Scholar] [CrossRef]
- Cipriani, C.; Pitzianti, M.B.; Matteucci, C.; D’Agati, E.; Miele, M.T.; Rapaccini, V.; Grelli, S.; Curatolo, P.; Sinibaldi-Vallebona, P.; Pasini, A.; et al. The Decrease in Human Endogenous Retrovirus-H Activity Runs in Parallel with Improvement in ADHD Symptoms in Patients Undergoing Methylphenidate Therapy. Int. J. Mol. Sci. 2018, 19, 3286. [Google Scholar]
- Balestrieri, E.; Matteucci, C.; Cipriani, C.; Grelli, S.; Ricceri, L.; Calamandrei, G.; Vallebona, P.S. Endogenous Retroviruses Activity as a Molecular Signature of Neurodevelopmental Disorders. Int. J. Mol. Sci. 2019, 20, 6050. [Google Scholar] [CrossRef] [Green Version]
- Belshaw, R.; Pereira, V.; Katzourakis, A.; Talbot, G.; Paces, J.; Burt, A.; Tristem, M. Long-term reinfection of the human genome by endogenous retroviruses. Proc. Natl. Acad. Sci. USA 2004, 101, 4894–4899. [Google Scholar] [CrossRef] [Green Version]
- Bannert, N.; Kurth, R. The evolutionary dynamics of human endogenous retroviral families. Annu. Rev. Genom. Hum. Genet. 2006, 7, 149–173. [Google Scholar] [CrossRef]
- Dewannieux, M.; Heidmann, T. Endogenous retroviruses: Acquisition, amplification and taming of genome invaders. Curr. Opin. Virol. 2013, 3, 646–656. [Google Scholar] [CrossRef] [PubMed]
- Jern, P.; Coffin, J.M. Effects of retroviruses on host genome function. Annu. Rev. Genet. 2008, 42, 709–732. [Google Scholar] [CrossRef] [PubMed]
- Balestrieri, E.; Pica, F.; Matteucci, C.; Zenobi, R.; Sorrentino, R.; Argaw-Denboba, A.; Cipriani, C.; Bucci, I.; Sinibaldi-Vallebona, P. Transcriptional activity of human endogenous retroviruses in human peripheral blood mononuclear cells. Biomed. Res. Int. 2015, 2015, 164529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matteucci, C.; Balestrieri, E.; Argaw-Denboba, A.; Sinibaldi-Vallebona, P. Human endogenous retroviruses role in cancer cell stemness. Semin. Cancer Biol. 2018, 53, 17–30. [Google Scholar] [CrossRef] [PubMed]
- Küry, P.; Nath, A.; Créange, A.; Dolei, A.; Marche, P.; Gold, J.; Giovannoni, G.; Hartung, H.P.; Perron, H. Human Endogenous Retroviruses in Neurological Diseases. Trends Mol. Med. 2018, 24, 379–394. [Google Scholar] [CrossRef] [Green Version]
- International Human Genome Sequencing Consortium. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860–921. [Google Scholar] [CrossRef] [Green Version]
- Mouse Genome Sequencing Consortium. Initial sequencing and comparative analysis of the mouse genome. Nature 2002, 420, 520–562. [Google Scholar] [CrossRef] [Green Version]
- Maksakova, I.A.; Romanish, M.T.; Gagnier, L.; Dunn, C.A.; van de Lagemaat, L.N.; Mager, D.L. Retroviral elements and their hosts: Insertional mutagenesis in the mouse germ line. PLoS Genet. 2006, 2, e2. [Google Scholar] [CrossRef] [Green Version]
- Sakashita, A.; Maezawa, S.; Takahashi, K.; Alavattam, K.G.; Yukawa, M.; Hu, Y.C.; Kojima, S.; Parrish, N.F.; Barski, A.; Pavlicev, M.; et al. Endogenous retroviruses drive species-specific germline transcriptomes in mammals. Nat. Struct. Mol. Biol. 2020, 27, 967–977. [Google Scholar] [CrossRef]
- Rowe, H.M.; Trono, D. Dynamic control of endogenous retroviruses during development. Virology 2011, 411, 273–287. [Google Scholar] [CrossRef] [Green Version]
- Cipriani, C.; Ricceri, L.; Matteucci, C.; De Felice, A.; Tartaglione, A.M.; Argaw-Denboba, A.; Pica, F.; Grelli, S.; Calamandrei, G.; Sinibaldi Vallebona, P.; et al. High expression of Endogenous Retroviruses from intrauterine life to adulthood in two mouse models of Autism Spectrum Disorders. Sci. Rep. 2018, 8, 629. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alexopoulou, L.; Holt, A.C.; Medzhitov, R.; Flavell, R.A. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 2001, 413, 732–738. [Google Scholar] [CrossRef] [PubMed]
- Tartaglione, A.M.; Cipriani, C.; Chiarotti, F.; Perrone, B.; Balestrieri, E.; Matteucci, C.; Sinibaldi-Vallebona, P.; Calamandrei, G.; Ricceri, L. Early Behavioral Alterations and Increased Expression of Endogenous Retroviruses Are Inherited Across Generations in Mice Prenatally Exposed to Valproic Acid. Mol. Neurobiol. 2019, 56, 3736–3750. [Google Scholar] [CrossRef]
- Blond, J.L.; Besème, F.; Duret, L.; Bouton, O.; Bedin, F.; Perron, H.; Mandrand, B.; Mallet, F. Molecular characterization and placental expression of HERV-W, a new human endogenous retrovirus family. J. Virol. 1999, 73, 1175–1185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mi, S.; Lee, X.; Li, X.; Veldman, G.M.; Finnerty, H.; Racie, L.; LaVallie, E.; Tang, X.Y.; Edouard, P.; Howes, S.; et al. Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 2000, 403, 785–789. [Google Scholar] [CrossRef]
- Tolosa, J.M.; Schjenken, J.E.; Clifton, V.L.; Vargas, A.; Barbeau, B.; Lowry, P.; Maiti, K.; Smith, R. The endogenous retroviral envelope protein syncytin-1 inhibits LPS/PHA-stimulated cytokine responses in human blood and is sorted into placental exosomes. Placenta 2012, 33, 933–941. [Google Scholar] [CrossRef]
- Bu, C.; Wang, Z.; Ren, Y.; Chen, D.; Jiang, S.W. Syncytin-1 nonfusogenic activities modulate inflammation and contribute to preeclampsia pathogenesis. Cell Mol. Life Sci. 2022, 79, 290. [Google Scholar] [CrossRef]
- Dupressoir, A.; Marceau, G.; Vernochet, C.; Bénit, L.; Kanellopoulos, C.; Sapin, V.; Heidmann, T. Syncytin-A and syncytin-B, two fusogenic placenta-specific murine envelope genes of retroviral origin conserved in Muridae. Proc. Natl. Acad. Sci. USA 2005, 102, 725–730. [Google Scholar] [CrossRef] [Green Version]
- Dupressoir, A.; Vernochet, C.; Harper, F.; Guégan, J.; Dessen, P.; Pierron, G.; Heidmann, T. A pair of co-opted retroviral envelope syncytin genes is required for formation of the two-layered murine placental syncytiotrophoblast. Proc. Natl. Acad. Sci. USA 2011, 108, E1164–E1173. [Google Scholar] [CrossRef] [Green Version]
- Asp, L.; Nellåker, C.; Karlsson, H. Influenza A virus transactivates the mouse envelope gene encoding syncytin B and its regulator, glial cells missing 1. J. Neurovirol. 2007, 13, 29–37. [Google Scholar] [CrossRef]
- Lavillette, D.; Marin, M.; Ruggieri, A.; Mallet, F.; Cosset, F.L.; Kabat, D. The envelope glycoprotein of human endogenous retrovirus type W uses a divergent family of amino acid transporters/cell surface receptors. J. Virol. 2002, 76, 6442–6452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheynet, V.; Oriol, G.; Mallet, F. Identification of the hASCT2-binding domain of the Env ERVWE1/syncytin-1 fusogenic glycoprotein. Retrovirology 2006, 3, 41. [Google Scholar] [CrossRef] [PubMed]
- Marin, M.; Lavillette, D.; Kelly, S.M.; Kabat, D. N-linked glycosylation and sequence changes in a critical negative control region of the ASCT1 and ASCT2 neutral amino acid transporters determine their retroviral receptor functions. J. Virol. 2003, 77, 2936–2945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grandi, N.; Tramontano, E. HERV Envelope Proteins: Physiological Role and Pathogenic Potential in Cancer and Autoimmunity. Front. Microbiol. 2018, 9, 462. [Google Scholar] [CrossRef]
- Song, Y.; Hou, G.; Diep, J.; Ooi, Y.S.; Akopyants, N.S.; Beverley, S.M.; Carette, J.E.; Greenberg, H.B.; Ding, S. Inhibitor of growth protein 3 epigenetically silences endogenous retroviral elements and prevents innate immune activation. Nucleic Acids Res. 2021, 49, 12706–12715. [Google Scholar] [CrossRef]
- Desai, V.P.; Chouaref, J.; Wu, H.; Pastor, W.A.; Kan, R.L.; Oey, H.M.; Li, Z.; Ho, J.; Vonk, K.K.D.; San Leon Granado, D.; et al. The role of MORC3 in silencing transposable elements in mouse embryonic stem cells. Epigenet. Chromatin 2021, 14, 49. [Google Scholar] [CrossRef]
- Toro, R.; Konyukh, M.; Delorme, R.; Leblond, C.; Chaste, P.; Fauchereau, F.; Coleman, M.; Leboyer, M.; Gillberg, C.; Bourgeron, T. Key role for gene dosage and synaptic homeostasis in autism spectrum disorders. Trends Genet. 2010, 26, 363–372. [Google Scholar] [CrossRef] [Green Version]
- Page, N.F.; Gandal, M.J.; Estes, M.L.; Cameron, S.; Buth, J.; Parhami, S.; Ramaswami, G.; Murray, K.; Amaral, D.G.; Van de Water, J.A.; et al. Alterations in Retrotransposition, Synaptic Connectivity, and Myelination Implicated by Transcriptomic Changes Following Maternal Immune Activation in Nonhuman Primates. Biol. Psychiatry 2021, 89, 896–910. [Google Scholar] [CrossRef]
- Hameete, B.C.; Fernández-Calleja, J.M.S.; de Groot, M.W.G.D.M.; Oppewal, T.R.; Tiemessen, M.M.; Hogenkamp, A.; de Vries, R.B.M.; Groenink, L. The poly(I:C)-induced maternal immune activation model; a systematic review and meta-analysis of cytokine levels in the offspring. Brain Behav. Immun. Health 2020, 11, 100192. [Google Scholar] [CrossRef]
- Ferrero-Miliani, L.; Nielsen, O.H.; Andersen, P.S.; Girardin, S.E. Chronic inflammation: Importance of NOD2 and NALP3 in interleukin-1beta generation. Clin. Exp. Immunol. 2007, 147, 227–235. [Google Scholar] [CrossRef]
- Gilman-Sachs, A.; Dambaeva, S.; Salazar Garcia, M.D.; Hussein, Y.; Kwak-Kim, J.; Beaman, K. Inflammation induced preterm labor and birth. J. Reprod. Immunol. 2018, 129, 53–58. [Google Scholar] [CrossRef] [PubMed]
- Weckman, A.M.; Ngai, M.; Wright, J.; McDonald, C.R.; Kain, K.C. The Impact of Infection in Pregnancy on Placental Vascular Development and Adverse Birth Outcomes. Front. Microbiol. 2019, 10, 1924. [Google Scholar] [CrossRef] [PubMed]
- Almeida, D.L.; Pavanello, A.; Saavedra, L.P.; Pereira, T.S.; de Castro-Prado, M.A.A.; de Freitas Mathias, P.C. Environmental monitoring and the developmental origins of health and disease. J. Dev. Orig. Health Dis. 2019, 10, 608–615. [Google Scholar] [CrossRef] [PubMed]
- McLellan, J.; Kim, D.H.J.; Bruce, M.; Ramirez-Celis, A.; Van de Water, J. Maternal Immune Dysregulation and Autism-Understanding the Role of Cytokines, Chemokines and Autoantibodies. Front. Psychiatry 2022, 13, 834910. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zoltewicz, J.S.; Mondello, S.; Newsom, K.J.; Yang, Z.; Yang, B.; Kobeissy, F.; Guingab, J.; Glushakova, O.; Robicsek, S.; et al. Human traumatic brain injury induces autoantibody response against glial fibrillary acidic protein and its breakdown products. PLoS ONE 2014, 9, e92698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carlezon, W.A., Jr.; Kim, W.; Missig, G.; Finger, B.C.; Landino, S.M.; Alexander, A.J.; Mokler, E.L.; Robbins, J.O.; Li, Y.; Bolshakov, V.Y.; et al. Maternal and early postnatal immune activation produce sex-specific effects on autism-like behaviors and neuroimmune function in mice. Sci. Rep. 2019, 9, 16928. [Google Scholar] [CrossRef] [Green Version]
- Nehyba, J.; Hrdlicková, R.; Bose, H.R. Dynamic evolution of immune system regulators: The history of the interferon regulatory factor family. Mol. Biol. Evol. 2009, 26, 2539–2550. [Google Scholar] [CrossRef] [PubMed]
- Grandi, N.; Tramontano, E. Human Endogenous Retroviruses Are Ancient Acquired Elements Still Shaping Innate Immune Responses. Front. Immunol. 2018, 9, 2039. [Google Scholar] [CrossRef] [Green Version]
- Zhao, X.; Zhao, Y.; Du, J.; Gao, P.; Zhao, K. The Interplay Among HIV, LINE-1, and the Interferon Signaling System. Front. Immunol. 2021, 12, 732775. [Google Scholar] [CrossRef]
- Wang, M.; Wang, L.; Liu, H.; Chen, J.; Liu, D. Transcriptome Analyses Implicate Endogenous Retroviruses Involved in the Host Antiviral Immune System through the Interferon Pathway. Virol. Sin. 2021, 36, 1315–1326. [Google Scholar] [CrossRef]
- Bartonicek, N.; Rouet, R.; Warren, J.; Loetsch, C.; Rodriguez, G.S.; Walters, S.; Lin, F.; Zahra, D.; Blackburn, J.; Hammond, J.M.; et al. The retroelement Lx9 puts a brake on the immune response to virus infection. Nature 2022, 608, 757–765. [Google Scholar] [CrossRef] [PubMed]
- Balestrieri, E.; Minutolo, A.; Petrone, V.; Fanelli, M.; Iannetta, M.; Malagnino, V.; Zordan, M.; Vitale, P.; Charvet, B.; Horvat, B.; et al. Evidence of the pathogenic HERV-W envelope expression in T lymphocytes in association with the respiratory outcome of COVID-19 patients. EBioMedicine 2021, 66, 103341. [Google Scholar] [CrossRef] [PubMed]
- Yizhar, O.; Levy, D.R. The social dilemma: Prefrontal control of mammalian sociability. Curr. Opin. Neurobiol. 2021, 68, 67–75. [Google Scholar] [CrossRef]
- Balestrieri, E.; Cipriani, C.; Matteucci, C.; Benvenuto, A.; Coniglio, A.; Argaw-Denboba, A.; Toschi, N.; Bucci, I.; Miele, M.T.; Grelli, S.; et al. Children with Autism Spectrum Disorder and Their Mothers Share Abnormal Expression of Selected Endogenous Retroviruses Families and Cytokines. Front. Immunol. 2019, 10, 2244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cipriani, C.; Giudice, M.; Petrone, V.; Fanelli, M.; Minutolo, A.; Miele, M.T.; Toschi, N.; Maracchioni, C.; Siracusano, M.; Benvenuto, A.; et al. Modulation of human endogenous retroviruses and cytokines expression in peripheral blood mononuclear cells from autistic children and their parents. Retrovirology 2022, in press. [Google Scholar]
- David, M.D. Endogenous Retroviruses and the Pregnancy Compensation Hypothesis: A Response to Natri et al. Trends Genet. 2020, 36, 2–3. [Google Scholar] [CrossRef]
- Konopko, M.A.; Densmore, A.L.; Krueger, B.K. Sexually Dimorphic Epigenetic Regulation of Brain-Derived Neurotrophic Factor in Fetal Brain in the Valproic Acid Model of Autism Spectrum Disorder. Dev. Neurosci. 2017, 39, 507–518. [Google Scholar] [CrossRef]
- Jeon, S.J.; Gonzales, E.L.; Mabunga, D.; Valencia, S.T.; Kim, D.G.; Kim, Y.; Adil, K.; Shin, D.; Park, D.; Shin, C.Y. Sex-specific Behavioral Features of Rodent Models of Autism Spectrum Disorder. Exp. Neurobiol. 2018, 27, 321–343. [Google Scholar] [CrossRef]
- Kazlauskas, N.; Seiffe, A.; Campolongo, M.; Zappala, C.; Depino, A.M. Sex-specific effects of prenatal valproic acid exposure on sociability and neuroinflammation: Relevance for susceptibility and resilience in autism. Psychoneuroendocrinology 2019, 110, 104441. [Google Scholar] [CrossRef]
- Chow, J.C.; Ciaudo, C.; Fazzari, M.J.; Mise, N.; Servant, N.; Glass, J.L.; Attreed, M.; Avner, P.; Wutz, A.; Barillot, E.; et al. LINE-1 Activity in Facultative Heterochromatin Formation during X Chromosome Inactivation. Cell 2016, 166, 782. [Google Scholar] [CrossRef]
- Baust, C.; Gagnier, L.; Baillie, G.J.; Harris, M.J.; Juriloff, D.M.; Mager, D.L. Structure and expression of mobile ETnII retroelements and their coding-competent MusD relatives in the mouse. J. Virol. 2003, 77, 11448–11458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Steward, O.; Farris, S.; Pirbhoy, P.S.; Darnell, J.; Driesche, S.J. Localization and local translation of Arc/Arg3.1 mRNA at synapses: Some observations and paradoxes. Front. Mol. Neurosci. 2015, 7, 101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suzuki, S.; Nozawa, Y.; Tsukamoto, S.; Kaneko, T.; Imai, H.; Minami, N. ING3 is essential for asymmetric cell division during mouse oocyte maturation. PLoS ONE 2013, 8, e74749. [Google Scholar] [CrossRef] [PubMed]
- Lucchina, L.; Depino, A.M. Altered peripheral and central inflammatory responses in a mouse model of autism. Autism Res. 2014, 7, 273–289. [Google Scholar] [CrossRef]
- Achek, A.; Kwon, H.K.; Patra, M.C.; Shah, M.; Hong, R.; Lee, W.H.; Baek, W.Y.; Choi, Y.S.; Kim, G.Y.; Pham, T.L.H.; et al. A peptide derived from the core β-sheet region of TIRAP decoys TLR4 and reduces inflammatory and autoimmune symptoms in murine models. EBioMedicine 2020, 52, 102645. [Google Scholar] [CrossRef]
Gene | Primers Pairs (5′ to 3′) | Ref. | |
---|---|---|---|
MusD | Forward | GTTAAACCCGAGCGCTGGTTC | [71] |
Reverse | GCTATAAGGCCCAGAGAGAAATTTC | ||
IAP | Forward | AAGCAGCAATCACCCACTTTG G | [71] |
Reverse | CAATCATTAGATGYGGCTGCCAAG | ||
LINE-1 ORF2 * | Forward | TGCAGAATTGACAAATGGGA | |
Reverse | ATCCTTTCCCAGTCTGTTGG | ||
Syn-A * | Forward | AGAGCCATGGTTCGTCCTTG | |
Reverse | CCAAGTCCTTAGTGGGGCTG | ||
Syn-B * | Forward | ACATTGAAAGACGCCTCCGT | |
Reverse | CGCCCTTCTGTCAGGATTGT | ||
ARC | Forward | GAGAGCTGAAAGGGTTGCAC | [72] |
Reverse | GCCTTGATGGACTTCTTCCA | ||
GLN * | Forward | ATCACCCTGCATCCAGTTTAG | |
Reverse | TATTGCCGCTAGGTCTTCATT | ||
ASCT-1 * | Forward | TATGCTGGGCCATGTCATCC | |
Reverse | GGAACAGGTCGCAAAAGCTG | ||
ASCT-2 * | Forward | GCCTGGTGGTCTTCGCTATC | |
Reverse | GGAACAGGATTCCAACGGGT | ||
MFSD2A * | Forward | CTCCTGGCCATCATGCTCTC | |
Reverse | GGCCACCAAGATGAGAAA | ||
MORC3 | Forward | TGTGAAGAGCTGCAGACTGA | |
Reverse | ATCAGGCACGATCATAGCCA | ||
ING3 | Forward | TTCACATACTCCCGTGGAAAA | [73] |
Reverse | GCGCTTCAGATTTGAATTTCTT | ||
IL-1β | Forward | TTGACGGACCCCAAAAGATG | [74] |
Reverse | AGAAGGTGCTCATGTCCTCA | ||
IL-6 | Forward | GTTCTCTGGGAAATCGTGGA | [74] |
Reverse | TGTACTCCAGGTAGCTATGG | ||
IFN-α * | Forward | TGCAGGAATTTCCCCTGACC | |
Reverse | GGCTCTCCAGACTTCTGCTC | ||
IFN-β | Forward | CGTGGGAGATGTCCTCAACT | [75] |
Reverse | AGATCTCTGCTCGGACCAACC | ||
TNF-α * | Forward | ATCGGTCCCCAAAGGGATGA | |
Reverse | TCCACTTGGTGGTTTGTGAGTG | ||
TGF-β1 | Forward | TGACGTCACTGGAGTTGTACGG | [74] |
Reverse | GGTTCATGTCATGGATGGTGC | ||
TLR-3 * | Forward | CCAGGCTCTGGAAACGCGCA | |
Reverse | ATGTGGAGGTGAGACAGCCCC | ||
TLR-4 * | Forward | AGATCTGAGCTTCAACCCCTTG | |
Reverse | ATTGTTTCAATTTCACACCTGGA | ||
TLR-7 * | Forward | TGGCTCCCTTCTCAGGATGA | |
Reverse | ATGTCTCTTGCTGCCCCAAA | ||
GFAP * | Forward | CAGATCCGAGAAACCAGCCT | |
Reverse | ACACCTCACATCACCACGTC | ||
GAPDH | Forward | AACGACCCCTTCATTGAC | [71] |
Reverse | CTCCACGACATACTCAGCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cipriani, C.; Tartaglione, A.M.; Giudice, M.; D’Avorio, E.; Petrone, V.; Toschi, N.; Chiarotti, F.; Miele, M.T.; Calamandrei, G.; Garaci, E.; et al. Differential Expression of Endogenous Retroviruses and Inflammatory Mediators in Female and Male Offspring in a Mouse Model of Maternal Immune Activation. Int. J. Mol. Sci. 2022, 23, 13930. https://doi.org/10.3390/ijms232213930
Cipriani C, Tartaglione AM, Giudice M, D’Avorio E, Petrone V, Toschi N, Chiarotti F, Miele MT, Calamandrei G, Garaci E, et al. Differential Expression of Endogenous Retroviruses and Inflammatory Mediators in Female and Male Offspring in a Mouse Model of Maternal Immune Activation. International Journal of Molecular Sciences. 2022; 23(22):13930. https://doi.org/10.3390/ijms232213930
Chicago/Turabian StyleCipriani, Chiara, Anna Maria Tartaglione, Martina Giudice, Erica D’Avorio, Vita Petrone, Nicola Toschi, Flavia Chiarotti, Martino Tony Miele, Gemma Calamandrei, Enrico Garaci, and et al. 2022. "Differential Expression of Endogenous Retroviruses and Inflammatory Mediators in Female and Male Offspring in a Mouse Model of Maternal Immune Activation" International Journal of Molecular Sciences 23, no. 22: 13930. https://doi.org/10.3390/ijms232213930